We narrowed to 3 results for: rosa26
-
TypeCollection...Cre-ERT2 with loxp cassette; Targeting vector for Rosa26 locus Mammalian Jacks 12238 pLOX-CW-CRE Cre CMV...Neo and stop cassette; Contains flanking arms for Rosa26 integration; See similar plasmid 11739 Mouse Targeting...EGFP-dsRed gene switch plasmid Mammalian Green 22799 Ai9 Rosa26 targeting vector, Cre dependent tdtomato expression...Cre-dependent Cas9 can be knocked in to a mouse at the Rosa26 locus to facilitate Cas9 mediated genome editing...
-
Zhang Lab CRISPR Page
TypeCollection...described below: 61408 : Targeting vector for the mouse Rosa26 locus; Used to make Cas9 knockin mouse Vectors ... -
Validated gRNA Sequences
TypeCollection...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes...