Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Showing: 1 - 2 of 2 results
  1. Mammalian RNAi Tools

    Type
    Collection
    ...David Root 1864 pLKO.1 ‐ scrambled shRNA Negative control vector containing scrambled shRNA David Sabatini...
  2. Validated gRNA Sequences

    Type
    Collection
    ...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285 interfere...
Showing: 1 - 2 of 2 results