We narrowed to 2 results for: Lambda RED

1. Sequencing Primers

   Type

   Guide

   ...terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter Forward pLXSN...signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG 3' end of DsRed1 Forward DsRed1-N GTACTGGAACTGGGGGGACAG...GTACTGGAACTGGGGGGACAG 5' end of DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone...

2. Molecular Biology Reference

   Type

   Guide

   ...supE44 ara14 galK2 lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZΔM15 ...division is reduced, as it takes more time to copy this extra DNA. Because of this reduced fitness, bacteria...In 1975, Frederick Sanger developed the process termed Sanger sequencing, sometimes referred to as chain-termination...researchers have also expanded the genetic code by redirecting some codons to encode for synthetic amino acids...would be necessary to isolate a sequence of a few hundred or a few thousand base pairs from the entire human...and other genetic elements using specifically engineered plasmids. These plasmids have become possibly... organisms, including plants, worms, mice, and cultured human cells. Have diverse applications — Although...