We narrowed to 2 results for: MPI
-
TypeGuide...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...., a gene whose product confers resistance to ampicillin) is included in the plasmid. These bacteria are... are then grown in the presence of ampicillin. Under these conditions, there is a selective pressure to...Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin* 100 mg/mL ... *Note: Carbenicillin can be used in place of ampicillin. Preparing Antibiotics Create a stock solution...
-
Sequencing Primers
TypeGuide...forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward ...