Skip to main content

We narrowed to 2 results for: MPI;

Showing: 1 - 2 of 2 results
  1. Molecular Biology Reference

    Type
    Guide
    ...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...., a gene whose product confers resistance to ampicillin) is included in the plasmid. These bacteria are... are then grown in the presence of ampicillin. Under these conditions, there is a selective pressure to...Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin* 100 mg/mL ... *Note: Carbenicillin can be used in place of ampicillin. Preparing Antibiotics Create a stock solution...
  2. Sequencing Primers

    Type
    Guide
    ...forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward ...
Showing: 1 - 2 of 2 results