Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 2 of 2 results
  1. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region...of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...
  2. CRISPR Guide

    Type
    Guide
    ...inactive dCas9 fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive...purification. Various epitope tags including 3xFLAG-tag, PA, and biotin tags, can be used for enChIP, as well... B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F. Nature . 520(7546):186-91. PMID: 25830891...
Showing: 1 - 2 of 2 results