We narrowed to 2 results for: PUR ALPHA-1

1. Sequencing Primers

   Type

   Guide

   ...promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, ...reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter, forward primer Xpress Forward... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC... as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer...

2. Molecular Biology Reference

   Type

   Guide

   ...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Delta(lac- proAB) [F ...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin...Techniques in chemistry enable isolation and purification of cellular components, such as DNA, but practically...far too many to separate from each other for the purposes of isolating one specific DNA sequence. This obstacle...contain the minimum essential DNA sequences for this purpose, which includes a DNA replication origin, an antibiotic-resistance...