Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 3 of 3 results

  1. Molecular Biology Reference

    Type
    Guide
    ...Letter Code Codons (RNA) Alanine Ala A GCU, GCC, GCA, GCG Arginine Arg R CGU, CGC, CGA, CGG, AGA, AGG Asparagine...

  2. Sequencing Primers

    Type
    Guide
    ...pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG (Waugh lab...MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse primer MT1-F GCTGTCCTCTAAGCGTCACC Mouse...NOS-F GCGTTCAAAAGTCGCCTAAG Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe...Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG (Waugh ...to 3′. Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...factor signal sequence, forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse...resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...

  3. CRISPR Guide

    Type
    Guide
    ...NGG (reduced NAG binding) SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3'...
Showing: 1 - 3 of 3 results