We narrowed to 2 results for: lacz gene

...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC...GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ Reverse LexA CGTCAGCAGAGCTTCACCATTG...pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose...neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F...

...promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA fragment cloned ...Expression Plasmids Used for gene expression, usually for the purposes of gene study. Expression vectors ... Backbones Gene Knock-down Plasmids Used for reducing the expression of an endogenous gene. This is frequently...Sequencing Primers Origins of Molecular Genetics The concept of genes as carriers of phenotypic information...scientists can easily study and manipulate genes and other genetic elements using specifically engineered ...studying the function of genetic elements. These plasmids contain a reporter gene (e.g., luciferase or GFP...chromosomes down to study their genes, marking the birth of molecular genetics. To learn more about different...