We narrowed to 2 results for: lacz gene

...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC...pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose...GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ Reverse LexA CGTCAGCAGAGCTTCACCATTG...neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F...

...promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA fragment cloned ...Expression Plasmids Used for gene expression, usually for the purposes of gene study. Expression vectors ... Backbones Gene Knock-down Plasmids Used for reducing the expression of an endogenous gene. This is frequently...biology. They allow scientists to isolate specific genes for study and have led to the understanding of many...Primers Origins of Molecular Genetics The concept of genes as carriers of phenotypic information was introduced...significant discoveries led to the conclusion that genes encode proteins and reside on chromosomes, which...and play important roles in cellular processes and gene regulation. Regions that code for proteins are transcribed...