We narrowed to 2 results for: tetracycline resistance

...of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA...

...antibiotic resistance and additional antibiotics, see our blog post on antibiotic resistance genes . Below...provide a benefit to the host, such as antibiotic resistance, and can be passed from one bacterium to another... origin of replication ( ori ), an antibiotic resistance gene, and at least one unique restriction enzyme...be copied (amplified) by bacteria. Antibiotic Resistance Gene Allows for selection of plasmid-containing...is typically in the form of another antibiotic resistance gene under the control of a non-bacterial promoter...very simple, often containing only a bacterial resistance gene, origin of replication, and an MCS. They...plasmids are designed to include an antibiotic resistance gene, which when expressed, allows only plasmid-containing...