We narrowed to 2 results for: tetracycline resistance

...of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...

...antibiotic resistance and additional antibiotics, see our blog post on antibiotic resistance genes . Below...provide a benefit to the host, such as antibiotic resistance, and can be passed from one bacterium to another... origin of replication ( ori ), an antibiotic resistance gene, and at least one unique restriction enzyme...be copied (amplified) by bacteria. Antibiotic Resistance Gene Allows for selection of plasmid-containing...is typically in the form of another antibiotic resistance gene under the control of a non-bacterial promoter...very simple, often containing only a bacterial resistance gene, origin of replication, and an MCS. They...plasmids are designed to include an antibiotic resistance gene, which when expressed, allows only plasmid-containing...