We narrowed to 2 results for: tetracycline resistance

1. Sequencing Primers

   Type

   Guide

   ...neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, ...primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...

2. Molecular Biology Reference

   Type

   Guide

   ...populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin) is included...providing a benefit to the host, such as antibiotic resistance. This benefit can be context-dependent, and thus...includes a DNA replication origin, an antibiotic-resistance gene, and a region in which exogenous DNA fragments... origin of replication ( ori ), an antibiotic-resistance gene, and at least one unique restriction enzyme...plasmids are convenient and easy to use. Antibiotic Resistance Gene Allows for selection of plasmid-containing... important to distinguish that the antibiotic resistance gene is under the control of a bacterial promoter...is typically in the form of another antibiotic resistance gene (this time, under the control of a non-bacterial...