We narrowed to 33 results for: REV;
-
TypeProtocol...PCR tubes. Put 50µl – 2.5µl (fwd primer) – 2.5µl (rev primer) = 45µl volume of master mix to add to each...primers for 30 seconds at 55°C: The forward and reverse primers are stable within this temperature range...nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 36.8 μL Sterile dH 2 O 0.2...nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 0.2 μL Taq DNA Polymerase ...DNA can be added to the master mix. Forward and Reverse Primers DO NOT get added to a master mix. Place...several times. Keep tube on ice. Add the forward and reverse primers to the thinned walled PCR tubes. Note: ... primer onto one side of the tube wall and the reverse primer onto the other. Add the master mix to the...
-
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol... 2012 ) fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT rev ITR primer, 5'-CGGCCTCAGTGAGCGA ITR-containing plasmid...water, then SYBR master mix, then the forward and reverse primers. Vortex briefly, immediately before use... μL 100 μM Forward Primer 0.15 μL 15 μL 100 μM Reverse Primer 0.15 μL 15 μL Nuclease Free Water 4.7 μL... made in step #1): Volume of 2 x 10 9 stock or previous dilution (μL) Volume of nuclease-free water (uL... -
Lentivirus ddPCR Titration
TypeProtocol...primers and probes targeting integrated copies of the Rev response element (RRE) in the target cells but can...tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol... replication. 5’LTR 5’ long terminal repeat. RRE Rev response element. A.3 Related Products The following... RNA polymerase III. Note that these were the prevailing guidelines when the pLKO.1 vector was created...CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG...AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC...the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1...concentration of 20 μM, then mix: 5 μL Forward oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2 O Incubate...TRC Cloning Vector The following steps were the prevailing guidelines when the pLKO.1 vector was created... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design is similar, but we need to use the reverse complement to get...primer and the downstream restriction site to the reverse primer. Next, we need to examine the DNA sequence...homology to the ORF). We now need to generate the reverse-complement of this sequence so that we can successfully...successfully amplify the ORF. You can generate the reverse-complement using existing software (a quick internet...others). If we put the sequence we chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-...TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA...digestion, you will need to use a phosphatase to prevent re-circularization of the vector. You should treat... -
Water Bath Protocol
TypeProtocol...water bath with distilled water, not tap water, to prevent salts from accumulating on the surfaces of the ...evaporates from the tub. Disinfectant may be added to prevent growth of bacteria or fungi. There are disinfectants...water bath cover on the top of the water bath to prevent evaporation and maintain the desired temperature...in the lab, you can leave the water in it from previous uses. However, you will still need to regularly... -
AAV ddPCR Titration
TypeProtocol...ITR: ITR Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT ITR Probe: -FAM-CACTCCCTCTCTGCGCGCTCG-BBQ...Forward ITR Primer (10 µM) 1.8 µL 16.2 µL 900 nM Reverse ITR Primer (10 µM) 1.8 µL 16.2 µL 900 nM Nuclease-free...tube, gently uncap the tubes. Add 5 µL of the previously aliquoted 1X dilution buffer from step 9 to the...titering using ddPCR, read our blog post. Last reviewed on: August 31, 2023... -
Kit Free RNA Extraction
TypeProtocol... affects the solubility of the RNA. Pro-Tip To prevent overdrying, watch the pellet and carefully remove...for RNA. Store your RNA sample(s) at -80 °C to prevent RNA degradation and avoid multiple freeze-thaw ... for RNA.Store your RNA sample(s) at -80 °C to prevent RNA degradation and avoid multiple freeze-thaw ... -
Weighing Reagents Protocol
TypeProtocol...might need to weigh it out in the fume hood to prevent exposure. Read the reagent’s material safety data...used to contain the material you’re weighing and prevent cross-contamination with other substances. They...spatula is clean, and sterile (if necessary), to prevent any potential contamination. Scoop out the material... -
Lentivirus Production
TypeProtocol... time, allow them to mix and recheck the pH to prevent over or undershooting the desired pH. Allow the...mix well. Gently aspirate the media out of the previously seeded 10 cm plate. Slowly pipette the transfection...images; right panels: GFP channel images. Last reviewed on: August 2, 2023... -
Colony Formation Titering Assay
TypeProtocol...Nalgene, 565-0010 (for viral preps, if prep was not previously filtered) Microcentrifuge tubes, Neptune 3745...mL polybrene: Dilution Volume of Lentivirus or Previous Dilution (μL) Volume of DMEM Complete Containing...colonies are visible in the higher dilutions. Last reviewed on: August 31, 2023... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol...Nalgene, 565-0010 (for viral preps, if prep was not previously filtered) Microcentrifuge tubes, Neptune 3745... plus one 'no virus' control well). Perform a "reverse transduction" by seeding 50,000 cells into each...11(8):783-4 (Link opens in a new window) . Last reviewed on: September 9, 2023... -
AAV Production in HEK293 Cells
TypeProtocol... time. Allow them to mix and recheck the pH to prevent over or undershooting the desired pH. Allow the...medium and pool with the cells harvested in the previous step. Pipette back and forth or shake vigorously...split 2 days before these images were taken. Last reviewed on: October 10, 2023... -
Protocol - How to Create a Bacterial Glycerol Stock
TypeProtocol...addition of glycerol stabilizes the frozen bacteria, preventing damage to the cell membranes and keeping the ...stock on dry ice while streaking onto LB agar will prevent it from thawing completely and will improve the... -
Fluorescence Titering Assay
TypeProtocol...Nalgene, 565-0010 (for viral preps, if prep was not previously filtered) Microcentrifuge tubes, Neptune 3745...expression using fluorescence microscopy. Last reviewed on: September 9, 2023... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol...in BSL-1, along with additional precautions to prevent injuries, ingestion, and exposures to hazardous... the work. Before working with chemicals, first review their material safety data sheets (MSDS). While... -
General Transfection
TypeProtocol... time, allow them to mix and recheck the pH to prevent over or undershooting the desired pH. Allow the...panels) with a limited effect on cell growth. Last reviewed on: November 7, 2023... -
Protocol - How to Ligate Plasmid DNA
TypeProtocol...insert will be added in the correct orientation and prevents the vector from ligating to itself during the ...phosphatase removes the 5' phosphate and therefore prevents the ligase from being able to fuse the two ends... -
Using a Light Microscope Protocol
TypeProtocol...and the other holding the arm - or use a cart. Revolve the nosepiece so that the lowest power objective...your eyes away from the eyepiece and carefully revolve the nosepiece so that the next objective is in ... -
Pipetting Protocol
TypeProtocol... needed to prevent contamination. When not in use, the tip box should be closed to prevent contamination...