We narrowed to 38 results for: cat.2

... solution can be stored at 4 °C for up to 2 months. After 2 months, discard the tube and thaw a new working...μg total DNA to μg PEI ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided...packaging cells Day 1 (pm): Transfect packaging cells Day 2 (am): 18 h post-transfection. Remove media, replace...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...culture plates. Incubate the cells at 37 °C, 5% CO 2 for ~20 h. Prepare a mixture of the three transfection...plasmid using a variety of ratios. Check the cells 1-2 days after transfection to determine what ratio gives...

...follows: Figure 2 Using the box tool, draw a box around the entire first gel lane (as in Figure 2). Select Analyze... Example for AR0018 (lane 2 in Figure 1): Sample Peak 1 (contaminant) Peak 2 (contaminant) Peak 3 (HC)...choose Use Equation . Select the Show R 2 checkbox. Pro-Tip The R 2 of the trendline should be between 0.95...Equipment Heat block 1–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... Add 5 µL of 4X sample buffer to each sample. Add 2 µL 10X reducing agent to each sample. Spin the sample...bottom part of the gel where dye is visible. Section 2: Staining the Gel Place the gel in a plastic tray .... Figure 1 Recombinant antibody preps should have 2 clear bands at ~50 kDa and ~25 kDa corresponding to...

... 95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold ...should decrease by a factor of 2 across the dilutions. In the example below, 2-fold serial dilutions of a ... considered biosafety level 1 but may require BSL-2 handling depending on the insert. Please ensure that...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...Hold 4 ∞ 2 1 After PCR is complete, transfer the plate to the Droplet Reader. Open the QuantaSoft software...

...transfer, block, incubate with primary antibody Day 2: Incubate with secondary antibody Video Watch this... Microcentrifuge 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...Heat block Mini gel tank chamber Power supply iBlot 2 Gel Transfer Device Roller Spatula Platform shaker...running buffer Prestained protein ladder Ethanol iBlot 2 PVDF Mini Stack, Thermo Fisher IB24002 20X TBS Tween...immediately or store at -80 °C until ready to use. Section 2: Determine the total protein concentration and prepare...in deionized water. To prepare 20% ethanol, dilute 2 mL of ethanol into 8 mL of deionized water and mix...the transfer sandwich as follows: Unseal the iBlot 2 PVDF Mini transfer stack. Set the Top Stack to one...

...method 1) or the volume of virus (method 2): Method 1 Method 2 $$T = {N*F*D\over V_T}$$ Where: T = Titer...downstream applications. Safety Warnings Lentivirus is generally considered biosafety level 2+. Please ...Day 0: Seed 293T cells Day 1: Transduce cells Day 2 (am): Remove media, replace with fresh media Day 4...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...complete. Mix well by pipetting or inverting. Aliquot 2 mL of cell suspension into each well of the 6-well...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...

...cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in a PCR tube. Place tube in a ...a thermocycler programmed to start at 95°C for 2 minutes. Then, gradually cool to 25°C over 45 minutes...vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and plate... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo...

... recover, set up overnight growth (Estimated time 2-3 hours) Transformation should be performed at the... day to ensure that growth times are limited. Day 2: Harvest cells and purify DNA (Estimated time 3-4 ... Tubes should contain a total of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate transformations...has been absorbed by the agar. This usually takes 1-2 minutes. Critical Be careful not to rip or shred the...incubation if needed. Place 100 mL sterile LB at 4 ℃. Day 2 (morning) Before beginning, prechill at least four...pellet. The total weight of each pellet should be ~1-2 g. Pro-Tip Make sure to weigh the empty tube beforehand... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...

...vapors. Workflow Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody incubation Day 4...with 96-well plates 1–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...serial dilutions of the purified antigen as follows: 2 ng/µL : Add 100 µL of 20 ng/µL stock into 900 µL PBS...microfuge tube and vortex. 1 ng/µL : Add 450 µL of 2 ng/µL stock into 450 uL PBS in a microfuge tube and...37 °C for 30 min , or overnight at 4 °C . Section 2: Block the plate Prepare the wash buffer (0.05% Tween...incubate on a microplate shaker set to 400 rpm for 2 h at room temperature or overnight at 4 °C . Section...

...mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH 2 O to 400 mL Note: If your lab has pre-mixed...start 2 mL in a Falcon tube. For larger preps, you might want to use as much as a liter of LB in a 2 L Erlenmeyer...antibiotic. Unless otherwise indicated, the antibiotic powder can be dissolved in dH 2 0. Addgene recommends ...individual plasmid within a single bacterial cell (Figure 2). Large plasmids usually have a low copy number (approximately...determine if your plasmid is high or low copy. Figure 2: High versus low copy plasmids in bacteria. Created...

...Warnings HEK293 cells are considered biosafety level 2. Please ensure that you are in compliance with your... 18, 2022 Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells Day 7: Harvest...conical tubes Automated cell counter 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 ...250 mg Benzamidine 25 mL Aprotinin saline solution (2 mg/mL) Mix well and sterilize through a 0.2 µm PES... a 500 mL vented flask.Incubate in a 37 °C, 5% CO 2 incubator on a shaking platform set to 120 rpm. Pro-Tip... not use cells that are over 30 passages. Section 2: Transfection Check the cell density and viability...the culture. Pro-Tip Culture should be between 1.5–2 x 10 6 cells/mL with >95% viability to proceed with...