Lentivirus ddPCR Titration
Type
Protocol
...green) and negative (black) droplets Sample ID Plasmid ID Dilution Copies/20 µL RRE (FAM) Copies/20 µL... transducing units and generally represents the number of infectious viral particles. Users may need to...primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244 Reagent ...1600 To calculate the titers, first calculate the number of viruses per cellular genome: Since the cellular...