We narrowed to 6 results for: tac promoter
-
TypeProtocol...) Pro-Tip Different brands and lots of FBS can promote or inhibit transfection. Test a variety of brands...viscosity of PEG. Stirring under medium heat will promote faster dissolution. Adjust the pH to ~7.4. Autoclave...flask, Corning 430825, 175 cm 2 Cellstack 5, Corning 3319, 3180 cm 2 Cellstack 2, Corning 3269, 1272 cm 2 ...-3 minutes for cells to detach. Gently tap the sides of the CS2 to help detach the cells, add 200 mL of...used to produce AAV from one Five Chambers Cell-Stack (CS5) (Link opens in a new window) (3,180 cm 2 -...the same surface area as 21 x T-175 flasks). Cell stacks provide an efficient means to scale-up without ...Pro-Tip While adherent, these cells are very loosely attached to the dish surface and should be handled carefully...
-
Fluorescence Titering Assay
TypeProtocol.... Pro-Tip Different brands and lots of FBS can promote or inhibit transfection. Test a variety of brands...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45 μm polyethersulfone filter... -
Lentivirus Production
TypeProtocol.... Pro-Tip Different brands and lots of FBS can promote or inhibit transfection. Test a variety of brands...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45 μm polyethersulfone filter... -
Colony Formation Titering Assay
TypeProtocol.... Pro-Tip Different brands and lots of FBS can promote or inhibit transfection. Test a variety of brands...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.1% Crystal Violet, Ward’... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol... °C. Pro-Tip Different brands and FBS lots can promote or inhibit transfection. Test a variety of brands...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45 μm polyethersulfone filter... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription for generation...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...(AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG...Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to ...Lentiviral Particles Before this step, you must contact your institution’s Bio-Safety office to receive...the OPTI-MEM – do not allow FuGENE® to come in contact with the walls of the tube before it has been diluted... 10% bleach. Laboratory materials that come in contact with viral particles should be treated as biohazardous...