Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMKO.1 puro p53 shRNA 2
(Plasmid #10672)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 10672 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMKO.1
  • Backbone size w/o insert (bp) 6700
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p53 shRNA
  • Alt name
    p53
  • gRNA/shRNA sequence
    GACTCCAGTGGTAATCTACT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    58
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pLXSN 5'
  • 3′ sequencing primer pBABE-3
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also reference: Stewart, S.A., Dykxhoorn, D.M., Palliser, D., Mizuno, H., Yu, E.Y., Eisen, H.N., Sabatini, D.M., Hahn, W.C., Sharp, P.A., Weinberg, R.A., et al. (2003). RNA 9, 493

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMKO.1 puro p53 shRNA 2 was a gift from William Hahn (Addgene plasmid # 10672 ; http://n2t.net/addgene:10672 ; RRID:Addgene_10672)
  • For your References section:

    Telomerase maintains telomere structure in normal human cells. Masutomi K, Yu EY, Khurts S, Ben-Porath I, Currier JL, Metz GB, Brooks MW, Kaneko S, Murakami S, DeCaprio JA, Weinberg RA, Stewart SA, Hahn WC. Cell. 2003 Jul 25. 114(2):241-53. 10.1016/S0092-8674(03)00550-6 PubMed 12887925