-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 10823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIRESneo
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5310
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArgonaute 3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2583
-
Mutation1 silent mutation
-
GenBank IDNM_024852
-
Entrez GeneAGO3 (a.k.a. EIF2C3)
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ggtaccgagctcggatcgat
- 3′ sequencing primer agctgttggggtgagtactcc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A small insertion in the 5'UTR should not affect the expressed peptide.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIreSneo-FLAG/HA Ago3 was a gift from Thomas Tuschl (Addgene plasmid # 10823 ; http://n2t.net/addgene:10823 ; RRID:Addgene_10823) -
For your References section:
Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Mol Cell. 2004 Jul 23. 15(2):185-97. 10.1016/j.molcel.2004.07.007 PubMed 15260970