-
PurposeStable suppression of miR-31 function
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBABE-puro
-
Backbone manufacturerWeinberg lab (Addgene#:1764)
- Backbone size w/o insert (bp) 5169
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-31
-
Alt namestable miR-31 sponge
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1100
-
MutationmiR-31 sponge with 7x tandem binding sites to the microRNA.
-
Entrez GeneMIR31 (a.k.a. MIRN31, hsa-mir-31, miR-31)
-
Tag
/ Fusion Protein
- * (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer pBabe-5
- 3′ sequencing primer pBabe-3 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Useful for stable suppression of miR-31 function.
Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel
Repeated sequence is: AGGCAAGACGAGGCATAGCT
*Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBABE-puro-mIR-31 sponge was a gift from Bob Weinberg (Addgene plasmid # 22694 ; http://n2t.net/addgene:22694 ; RRID:Addgene_22694) -
For your References section:
A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507