Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBABE-puro-mIR-31 sponge
(Plasmid #22694)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22694 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBABE-puro
  • Backbone manufacturer
    Weinberg lab (Addgene#:1764)
  • Backbone size w/o insert (bp) 5169
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-31
  • Alt name
    stable miR-31 sponge
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1100
  • Mutation
    miR-31 sponge with 7x tandem binding sites to the microRNA.
  • Entrez Gene
    MIR31 (a.k.a. MIRN31, hsa-mir-31, miR-31)
  • Tag / Fusion Protein
    • * (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer pBabe-5
  • 3′ sequencing primer pBabe-3
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Useful for stable suppression of miR-31 function.

Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel

Repeated sequence is: AGGCAAGACGAGGCATAGCT

*Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBABE-puro-mIR-31 sponge was a gift from Bob Weinberg (Addgene plasmid # 22694 ; http://n2t.net/addgene:22694 ; RRID:Addgene_22694)
  • For your References section:

    A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507