This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy in light of the new GDPR standards. When logging in or creating a new account, you will be asked to read and acknowledge these policy changes. Additionally, you can find our Transparency and Privacy Policy here.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #37807)


Item Catalog # Description Quantity Price (USD)
Plasmid 37807 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    AAV with CaMKII promoter
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5088
  • Vector type
    Mammalian Expression, AAV ; Adeno-associated virus

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli (Stbl3, XL-10, Sure2 and DH5a, grow at 30C
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Alt name
    archaerhodopsin TP009
  • Alt name
  • Species
    H. strain TP009
  • Insert Size (bp)
  • Mutation
  • Promoter CamKII
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaggctgtgagcagccacag
  • 3′ sequencing primer aaagagacagcaaccagg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CamKII-ArchT-GFP was a gift from Edward Boyden (Addgene plasmid # 37807)
  • For your References section:

    A high-light sensitivity optical neural silencer: development and application to optogenetic control of non-human primate cortex. Han X, Chow BY, Zhou H, Klapoetke NC, Chuong A, Rajimehr R, Yang A, Baratta MV, Winkle J, Desimone R, Boyden ES. Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13. 10.3389/fnsys.2011.00018 PubMed 21811444