pTorPE-Y-GECO1
(Plasmid
#55765)
-
PurposeEncoded a yellow fluorescent calcium ion indicator with inverted fluorescence response for expression in bacterial cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 55765 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustomized Vector
- Backbone size w/o insert (bp) 4125
-
Vector typeBacterial Expression ; Lab constructed
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameY-GECO1.0
-
Alt nameA yellow fluorescent calcium ion indicator with inverted fluorescent response
-
SpeciesSynthetic
-
Insert Size (bp)1368
-
GenBank IDKJ193859
- Promoter pBAD
-
Tag
/ Fusion Protein
- 6x His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector is modified from pBAD/ His B (Invitrogen).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTorPE-Y-GECO1 was a gift from Robert Campbell (Addgene plasmid # 55765 ; http://n2t.net/addgene:55765 ; RRID:Addgene_55765) -
For your References section:
Microfluidic cell sorter-aided directed evolution of a protein-based calcium ion indicator with an inverted fluorescent response. Zhao Y, Abdelfattah AS, Zhao Y, Ruangkittisakul A, Ballanyi K, Campbell RE, Harrison DJ. Integr Biol (Camb). 2014 May 19. 10.1039/c4ib00039k PubMed 24840546