Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #59701)


Item Catalog # Description Quantity Price (USD)
Plasmid 59701 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6886
  • Total vector size (bp) 8870
  • Modifications to backbone
    AcGFP1 is removed during cloning. Cre-ERT2 is cloned into NheI/EcoRI site by Gibson assembly
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    inducible Cre
  • Species
    Bacteriophage P1
  • Insert Size (bp)
  • Promoter cmvIE
  • Tag / Fusion Protein
    • Estrogen receptor (ERT) (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGT CTA TAT AAG CAG AGC TG
  • 3′ sequencing primer CGAAGGGGCCACCAAAGAAC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

ERT2-Cre-ERT2 in the same retrovirus vector (pRetroQ) has too low activity in stable cell line to prevent it to be useful. pRetroQ-Cre-ERT2 made stable cell line exhibits no leaky Cre activity whereas pCAG-Cre-ERT2 transient expression does lead to leaky Cre activity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRetroQ-Cre-ERT2 was a gift from Richard Youle (Addgene plasmid # 59701 ; ; RRID:Addgene_59701)