pRetroQ-Cre-ERT2
(Plasmid #59701)

• Purpose: to make Cre-ERT2 expressing stable cell line by retrovirus
• Depositing Lab: Richard Youle
• Publication: pRetroQ-Cre-ERT2 (unpublished)

Backbone

• Vector backbone: pRetroQ-AcGFP1-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6886
• Total vector size (bp): 8870
• Modifications to backbone: AcGFP1 is removed during cloning. Cre-ERT2 is cloned into NheI/EcoRI site by Gibson assembly
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Cre-ERT2
• Alt name: inducible Cre
• Species: Bacteriophage P1
• Insert Size (bp): 1983
• Promoter: cmvIE
• Tag / Fusion Protein:
  • Estrogen receptor (ERT) (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGT CTA TAT AAG CAG AGC TG
• 3′ sequencing primer: CGAAGGGGCCACCAAAGAAC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ERT2-Cre-ERT2 in the same retrovirus vector (pRetroQ) has too low activity in stable cell line to prevent it to be useful. pRetroQ-Cre-ERT2 made stable cell line exhibits no leaky Cre activity whereas pCAG-Cre-ERT2 transient expression does lead to leaky Cre activity.