pX330-H11r1-2-DD-Cas9
(Plasmid
#85978)
-
PurposeExpresses DD-SpCas9 in mammalian cells and targets the H11 locus in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 85978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonemodified pX330
-
Modifications to backboneBbsI sites in sgRNA replaced with 2 BsaI sites
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDD-SpCas9
-
gRNA/shRNA sequenceCAAAATAGGTTAGCCTTGCG
-
Insert Size (bp)4599
-
Tag
/ Fusion Protein
- FKBP12 L106P DD (N terminal on insert)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
Depositor Comments
DD domain tested for stabilization with 500 nM Shield-1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-H11r1-2-DD-Cas9 was a gift from Michele Calos (Addgene plasmid # 85978 ; http://n2t.net/addgene:85978 ; RRID:Addgene_85978) -
For your References section:
In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Geisinger JM, Turan S, Hernandez S, Spector LP, Calos MP. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542. 10.1093/nar/gkv1542 PubMed 26762978