Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pNOC-CRISPR
(Plasmid #100008)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100008 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pNOC-CRISPR-HA
  • Backbone size (bp) 12919
  • Vector type
    Algae, Nannochloropsis expression
  • Promoter Ribi promoter
  • Selectable markers
    Hygromycin
  • Tag / Fusion Protein
    • Cas9-Nlux (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GTTAAC ATGGTGTTTACTCTCGAGGAC
  • 3′ sequencing primer GCTAGCcaccatGGACGCGTAGTCGGGCACGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNOC-CRISPR was a gift from Eva Farre (Addgene plasmid # 100008 ; http://n2t.net/addgene:100008 ; RRID:Addgene_100008)
  • For your References section:

    Nontransgenic Marker-Free Gene Disruption by an Episomal CRISPR System in the Oleaginous Microalga, Nannochloropsis oceanica CCMP1779. Poliner E, Takeuchi T, Du ZY, Benning C, Farre EM. ACS Synth Biol. 2018 Apr 20;7(4):962-968. doi: 10.1021/acssynbio.7b00362. Epub 2018 Mar 14. 10.1021/acssynbio.7b00362 PubMed 29518315