pNOC-CRISPR-GFP
(Plasmid
#100009)
-
Purpose(Empty Backbone) Expresses Cas9-GFP and sgRNA in Nannochloropsis oceanica, contains hygromycin resistance cassette, for integration into geneome
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepNOC-stacked-Cas9-sgRNA
- Backbone size (bp) 13072
-
Vector typeAlgae, Nannochloropsis expression
- Promoter Ribi promoter
-
Selectable markersHygromycin
-
Tag
/ Fusion Protein
- Cas9-GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer aatcgatAGGCCTTGGTACCATGGGAAAGAAAGGATGAGAA
- 3′ sequencing primer gggttgaccggtgcaaagctgacgcccttttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNOC-CRISPR-GFP was a gift from Eva Farre (Addgene plasmid # 100009 ; http://n2t.net/addgene:100009 ; RRID:Addgene_100009) -
For your References section:
Nontransgenic Marker-Free Gene Disruption by an Episomal CRISPR System in the Oleaginous Microalga, Nannochloropsis oceanica CCMP1779. Poliner E, Takeuchi T, Du ZY, Benning C, Farre EM. ACS Synth Biol. 2018 Apr 20;7(4):962-968. doi: 10.1021/acssynbio.7b00362. Epub 2018 Mar 14. 10.1021/acssynbio.7b00362 PubMed 29518315