pGL4-Cluster Promoter Delta 3
(Plasmid
#100128)
-
PurposeIt contains ~2.7 Kb of the miR-183-96-182 cluster promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4302
- Total vector size (bp) 7030
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-183-96-82 Cluster promoter 2.7Kb Fragment
-
Alt namemiR-182 cluster promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2728
-
Entrez GeneMIR182 (a.k.a. MIRN182, miRNA182, mir-182)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer TAGCAAAATAGGCTGTCCCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's sequencing results found two discrepancies compared to the depositor's sequence: 666delG, 1358G>T, 1511C>T. These differences could be SNPs and do not occur near the binding sites of the transcription factors of interest; thus they should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4-Cluster Promoter Delta 3 was a gift from Eva Hernando (Addgene plasmid # 100128 ; http://n2t.net/addgene:100128 ; RRID:Addgene_100128) -
For your References section:
Kruppel-like factor 4 (KLF4) regulates the miR-183~96~182 cluster under physiologic and pathologic conditions. Segura MF, Jubierre L, Li S, Soriano A, Koetz L, Gaziel-Sovran A, Masanas M, Kleffman K, Dankert JF, Walsh MJ, Hernando E. Oncotarget. 2017 Apr 18;8(16):26298-26311. doi: 10.18632/oncotarget.15459. 10.18632/oncotarget.15459 PubMed 28412746