Skip to main content

pGL4-Cluster Promoter Delta 3
(Plasmid #100128)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100128 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL4
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4302
  • Total vector size (bp) 7030
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-183-96-82 Cluster promoter 2.7Kb Fragment
  • Alt name
    miR-182 cluster promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2728
  • Entrez Gene
    MIR182 (a.k.a. MIRN182, miRNA182, mir-182)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer TAGCAAAATAGGCTGTCCCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's sequencing results found two discrepancies compared to the depositor's sequence: 666delG, 1358G>T, 1511C>T. These differences could be SNPs and do not occur near the binding sites of the transcription factors of interest; thus they should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4-Cluster Promoter Delta 3 was a gift from Eva Hernando (Addgene plasmid # 100128 ; http://n2t.net/addgene:100128 ; RRID:Addgene_100128)
  • For your References section:

    Kruppel-like factor 4 (KLF4) regulates the miR-183~96~182 cluster under physiologic and pathologic conditions. Segura MF, Jubierre L, Li S, Soriano A, Koetz L, Gaziel-Sovran A, Masanas M, Kleffman K, Dankert JF, Walsh MJ, Hernando E. Oncotarget. 2017 Apr 18;8(16):26298-26311. doi: 10.18632/oncotarget.15459. 10.18632/oncotarget.15459 PubMed 28412746