Skip to main content

pGL4 Cluster Promoter Delta 1.2
(Plasmid #100130)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100130 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL4
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4322
  • Total vector size (bp) 4863
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-183-96-82 Cluster promoter 0.5 Kb Fragment
  • Alt name
    miR-182 cluster promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    541
  • Entrez Gene
    MIR182 (a.k.a. MIRN182, miRNA182, mir-182)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TAGCAAAATAGGCTGTCCCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4 Cluster Promoter Delta 1.2 was a gift from Eva Hernando (Addgene plasmid # 100130 ; http://n2t.net/addgene:100130 ; RRID:Addgene_100130)
  • For your References section:

    Kruppel-like factor 4 (KLF4) regulates the miR-183~96~182 cluster under physiologic and pathologic conditions. Segura MF, Jubierre L, Li S, Soriano A, Koetz L, Gaziel-Sovran A, Masanas M, Kleffman K, Dankert JF, Walsh MJ, Hernando E. Oncotarget. 2017 Apr 18;8(16):26298-26311. doi: 10.18632/oncotarget.15459. 10.18632/oncotarget.15459 PubMed 28412746