Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #100276)


Item Catalog # Description Quantity Price (USD)
Plasmid 100276 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    GFAP promoter
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Entrez Gene
    Gfap (a.k.a. AI836096)
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer aaagtggcaccgagtcggtgcTTTTTTtctagaagagggc
  • 3′ sequencing primer cccagcacagagagggaggtgg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that some sequence discrepancies were found between Addgene's quality control and the depositor's genbank sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6sgp53-mTSG-GFAPCre was a gift from Sidi Chen (Addgene plasmid # 100276 ; ; RRID:Addgene_100276)
  • For your References section:

    AAV-mediated direct in vivo CRISPR screen identifies functional suppressors in glioblastoma. Chow RD, Guzman CD, Wang G, Schmidt F, Youngblood MW, Ye L, Errami Y, Dong MB, Martinez MA, Zhang S, Renauer P, Bilguvar K, Gunel M, Sharp PA, Zhang F, Platt RJ, Chen S. Nat Neurosci. 2017 Aug 14. doi: 10.1038/nn.4620. 10.1038/nn.4620