Skip to main content

pcDNA-Flag-Kdm6b(1025-End)-pA
(Plasmid #100278)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100278 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kdm6b
  • Alt name
    Jmjd3
  • Species
    M. musculus (mouse)
  • Mutation
    catalytic domain (1025aa-End)
  • Entrez Gene
    Kdm6b (a.k.a. 1700064E03Rik, Jmjd3)
  • Promoter T7
  • Tag / Fusion Protein
    • Flag epitope tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer CCAAACTTTTATTTGTGCACAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-Flag-Kdm6b(1025-End)-pA was a gift from Yi Zhang (Addgene plasmid # 100278 ; http://n2t.net/addgene:100278 ; RRID:Addgene_100278)
  • For your References section:

    Maternal H3K27me3 controls DNA methylation-independent imprinting. Inoue A, Jiang L, Lu F, Suzuki T, Zhang Y. Nature. 2017 Jul 19. doi: 10.1038/nature23262. 10.1038/nature23262 PubMed 28723896