-
PurposeExpression of human transglutaminase 2 in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 7900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTGM2
-
Alt nametransglutaminase 2
-
Alt nameProtein-glutamine gamma-glutamyltransferase 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2064
-
Mutationsilent mutation Arg580 (AGG--CGT) to enhance expression in E.coli
-
Entrez GeneTGM2 (a.k.a. G(h), TG(C), TGC, hTG2, tTG)
- Promoter T7
-
Tag
/ Fusion Protein
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
- 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
hTG2 has a V224G mutation that does not affect plasmid function or TG2 activity.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHis-hTG2 was a gift from Byung Il Lee (Addgene plasmid # 100719 ; http://n2t.net/addgene:100719 ; RRID:Addgene_100719) -
For your References section:
Crystal structure of human transglutaminase 2 in complex with adenosine triphosphate. Han BG, Cho JW, Cho YD, Jeong KC, Kim SY, Lee BI. Int J Biol Macromol. 2010 Aug 1;47(2):190-5. doi: 10.1016/j.ijbiomac.2010.04.023. Epub 2010 May 5. 10.1016/j.ijbiomac.2010.04.023 PubMed 20450932