This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHis-hTG2
(Plasmid #100719)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100719 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 7900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TGM2
  • Alt name
    transglutaminase 2
  • Alt name
    Protein-glutamine gamma-glutamyltransferase 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2064
  • Mutation
    silent mutation Arg580 (AGG--CGT) to enhance expression in E.coli
  • Entrez Gene
    TGM2 (a.k.a. TG(C), TGC)
  • Promoter T7
  • Tag / Fusion Protein
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
  • 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

hTG2 has a V224G mutation that does not affect plasmid function or TG2 activity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHis-hTG2 was a gift from Byung Il Lee (Addgene plasmid # 100719 ; http://n2t.net/addgene:100719 ; RRID:Addgene_100719)
  • For your References section:

    Crystal structure of human transglutaminase 2 in complex with adenosine triphosphate. Han BG, Cho JW, Cho YD, Jeong KC, Kim SY, Lee BI. Int J Biol Macromol. 2010 Aug 1;47(2):190-5. doi: 10.1016/j.ijbiomac.2010.04.023. Epub 2010 May 5. 10.1016/j.ijbiomac.2010.04.023 PubMed 20450932