pHis-hTG2
(Plasmid #100719)

• Purpose: Expression of human transglutaminase 2 in E.coli
• Depositing Lab: Byung Il Lee
• Publication: Han et al Int J Biol Macromol. 2010 Aug 1;47(2):190-5. doi: 10.1016/j.ijbiomac.2010.04.023. Epub 2010 May 5.

Backbone

• Vector backbone: pET28
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5900
• Total vector size (bp): 7900
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: TGM2
• Alt name: transglutaminase 2
• Alt name: Protein-glutamine gamma-glutamyltransferase 2
• Species: H. sapiens (human)
• Insert Size (bp): 2064
• Mutation: silent mutation Arg580 (AGG--CGT) to enhance expression in E.coli
• Entrez Gene: TGM2 (a.k.a. G(h), TG(C), TGC, hTG2, tTG)
• Promoter: T7
• Tag / Fusion Protein:
  • His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG (T7 promoter primer)
• 3′ sequencing primer: CCGCTGAGCAATAACTAGC (T7 terminator primer)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

hTG2 has a V224G mutation that does not affect plasmid function or TG2 activity.