pHis-hPim1
(Plasmid #100722)

• Purpose: Expression of human Pim1 kinase domain in E.coli
• Depositing Lab: Byung Il Lee
• Publication: Lee et al PLoS One. 2013 Jul 31;8(7):e70358. doi: 10.1371/journal.pone.0070358. Print 2013.

Backbone

• Vector backbone: pET28
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5900
• Total vector size (bp): 6750
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Pim1
• Species: H. sapiens (human)
• Insert Size (bp): 852
• Mutation: Residues 29-313 of isoform 2
• Entrez Gene: PIM1 (a.k.a. PIM)
• Promoter: T7 promotor
• Tag / Fusion Protein:
  • His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG (T7 promoter primer)
• 3′ sequencing primer: CCGCTGAGCAATAACTAGC (T7 terminator primer)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry