-
PurposeMammalian expression of PRKACA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCR3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6076
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProtein Kinase CAMP-Activated Catalytic Subunit Alpha
-
Alt namePRKACA
-
Alt namePKA C-Alpha
-
SpeciesH. sapiens (human)
-
MutationIsoform 1 wild type
-
GenBank IDNM_002730.3
-
Entrez GenePRKACA (a.k.a. CAFD1, PKACA, PPNAD4)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert was artificially synthesized
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcrDNA3.1-PRKACA was a gift from Sanford Simon (Addgene plasmid # 100890 ; http://n2t.net/addgene:100890 ; RRID:Addgene_100890) -
For your References section:
Detection of a recurrent DNAJB1-PRKACA chimeric transcript in fibrolamellar hepatocellular carcinoma. Honeyman JN, Simon EP, Robine N, Chiaroni-Clarke R, Darcy DG, Lim II, Gleason CE, Murphy JM, Rosenberg BR, Teegan L, Takacs CN, Botero S, Belote R, Germer S, Emde AK, Vacic V, Bhanot U, LaQuaglia MP, Simon SM. Science. 2014 Feb 28;343(6174):1010-4. doi: 10.1126/science.1249484. 10.1126/science.1249484 PubMed 24578576