Skip to main content

pGL4.18 CMV-Luc
(Plasmid #100984)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100984 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL4.18
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CMV
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer GACGATAGTCATGCCCCGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.18 CMV-Luc was a gift from Lee Helman (Addgene plasmid # 100984 ; http://n2t.net/addgene:100984 ; RRID:Addgene_100984)
  • For your References section:

    Identification of an inhibitor of the EWS-FLI1 oncogenic transcription factor by high-throughput screening. Grohar PJ, Woldemichael GM, Griffin LB, Mendoza A, Chen QR, Yeung C, Currier DG, Davis S, Khanna C, Khan J, McMahon JB, Helman LJ. J Natl Cancer Inst. 2011 Jun 22;103(12):962-78. doi: 10.1093/jnci/djr156. Epub 2011 Jun 8. 10.1093/jnci/djr156 PubMed 21653923