-
Purpose(Empty Backbone) Luciferase reporter plasmid. Note that both renilla luciferase and ORF-firefly luciferase are encoded by a single mRNA and both are translated independently via internal ribosomal binding sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV
- Backbone size (bp) 7509
-
Vector typeMammalian Expression
- Promoter CMV
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 3′ sequencing primer AAGAGAGTTTTCACTGCATAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-IRES-Renilla Luciferase-IRES-Gateway-Firefly Luciferase (pIRIGF) was a gift from William Kaelin (Addgene plasmid # 101139 ; http://n2t.net/addgene:101139 ; RRID:Addgene_101139) -
For your References section:
The myeloma drug lenalidomide promotes the cereblon-dependent destruction of Ikaros proteins. Lu G, Middleton RE, Sun H, Naniong M, Ott CJ, Mitsiades CS, Wong KK, Bradner JE, Kaelin WG Jr. Science. 2014 Jan 17;343(6168):305-9. doi: 10.1126/science.1244917. Epub 2013 Nov 29. 10.1126/science.1244917 PubMed 24292623