Skip to main content
Addgene

pIVTRup
(Plasmid #101362)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101362 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRII topo-TA
  • Backbone manufacturer
    Invitrogene
  • Backbone size w/o insert (bp) 3900
  • Total vector size (bp) 4244
  • Vector type
    For cloning a gene for in vitro transcription purposes

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5'UTR-EcoRV site-3'UTR-pAtrack(55 pA)
  • Species
    X. laevis (frog)
  • Promoter T7

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is intended to be used as a platform for in vitro transcription. GOI can be cloned at EcoRV site in blunt. Template for IVT is obtained by PCR with forward primer consisting on a primer that contains the T7 promoter sequence and part of the 5’UTR (5’ TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAG 3’) and a 55 polyT (or longer) as reverse primer. No need for polyA polimerase treatment after IVT. Resulting mRNA will contain 5’UTR-GOI-3’UTR-pA (55bp or longer) and it is ready to be transfected.
UTRs are from X. laevis and β-globin gene and can be used for H. sapiens and M. musculus.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIVTRup was a gift from Ángel Raya (Addgene plasmid # 101362 ; http://n2t.net/addgene:101362 ; RRID:Addgene_101362)