pAAV hSyn1 CaRhAC T2A tDimer
(Plasmid
#101722)
-
Purpose- humanized - variant of pAAV hSyn YFP-CaRhAC Addgene # 101721– less reliable in hippocampal neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4568
- Total vector size (bp) 7970
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCatRhAC
-
Alt nameCaCyclOP
-
SpeciesCateneraria anguillulae
-
Insert Size (bp)1867
-
MutationE497K,C569D
- Promoter human Synapsin1 promotor
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer gactcagcgctgcctcagtctg
- 3′ sequencing primer GGATTCTCCTCCACGTCACCGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt nametDimer2
-
SpeciesDiscoma sp.
-
Insert Size (bp)1395
- Promoter ribosomal skip sequence T2A
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggcagaggaagtcttctaacat
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byCaRhGC originally from P.Hegemann ,HU-Berlin Germany tDimer originally from R.Tsien USD USA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hSyn1 CaRhAC T2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 101722 ; http://n2t.net/addgene:101722 ; RRID:Addgene_101722) -
For your References section:
Rhodopsin-cyclases for photocontrol of cGMP/cAMP and 2.3 A structure of the adenylyl cyclase domain. Scheib U, Broser M, Constantin OM, Yang S, Gao S, Mukherjee S, Stehfest K, Nagel G, Gee CE, Hegemann P. Nat Commun. 2018 May 24;9(1):2046. doi: 10.1038/s41467-018-04428-w. 10.1038/s41467-018-04428-w PubMed 29799525