- 
            PurposeLuciferase reporter plasmid containing three tandem repeats of the unfolded protein response element (UPRE)
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepGL4.29
 - 
              Backbone manufacturerPromega
 - 
              Vector typeMammalian Expression, Luciferase
 - 
                Selectable markersHygromycin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert name3xUPRE
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)87
 - Promoter minimal TATA-box promoter with low basal activity
 - 
    
        Tag
        / Fusion Protein
    
- Luciferase (C terminal on backbone)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site NheI (not destroyed)
 - 3′ cloning site BglII (not destroyed)
 - 5′ sequencing primer ctaactggccggtacctgag
 - 3′ sequencing primer aacagtaccggattgccaag (Common Sequencing Primers)
 
Resource Information
- 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pGL4-UPRE-luc2P-Hygro was a gift from Seiichi Oyadomari (Addgene plasmid # 101788 ; http://n2t.net/addgene:101788 ; RRID:Addgene_101788) - 
                
For your References section:
Dkk3/REIC, an N-glycosylated Protein, Is a Physiological Endoplasmic Reticulum Stress Inducer in the Mouse Adrenal Gland. Fujita H, Bando T, Oyadomari S, Ochiai K, Watanabe M, Kumon H, Ohuchi H. Acta Med Okayama. 2020 Jun;74(3):199-208. doi: 10.18926/AMO/59950. 10.18926/AMO/59950 PubMed 32577017