pET_BGL1
(Plasmid
#101910)
-
PurposeExpresses a β-glucosidase gene from Thermomicrobium roseum in E. coli under the control of the pET system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET16b
- Backbone size w/o insert (bp) 5711
- Total vector size (bp) 6999
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameβ-glucosidase
-
Alt namebgl
-
SpeciesThermomicrobium roseum
-
Insert Size (bp)1359
-
GenBank IDWP_015922700.1
- Promoter T7+LacO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ttcccctctagaaataattttgtttaactttaagaag
- 3′ sequencing primer gcagccggatccCTAACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET_BGL1 was a gift from Steve Shih (Addgene plasmid # 101910 ; http://n2t.net/addgene:101910 ; RRID:Addgene_101910) -
For your References section:
An Automated Induction Microfluidics System for Synthetic Biology. Husser MC, Vo PQN, Sinha H, Ahmadi F, Shih SCC. ACS Synth Biol. 2018 Mar 16;7(3):933-944. doi: 10.1021/acssynbio.8b00025. Epub 2018 Mar 8. 10.1021/acssynbio.8b00025 PubMed 29516725