Skip to main content
Addgene

pCBB
(Plasmid #102248)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102248 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pZA11MCS
  • Backbone manufacturer
    Expressys, Germany
  • Backbone size w/o insert (bp) 4987
  • Total vector size (bp) 8187
  • Modifications to backbone
    specified in the article
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Upon transformation of the pCBB vector grow the cells in elevated CO2 atmosphere (>2% CO2) or alternatively add sodium bicarbonate to the growth media (final concertation 30 mM)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cbbM, prkA, CA
  • Species
    Rhodospirillum rubrum ATCC 11170, Synechococcus elongatus PCC 7942
  • Insert Size (bp)
    3200
  • GenBank ID
    ANI70198.1 ANI70199.1
  • Promoter tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AAAATAGGCGTATCACGAGG
  • 3′ sequencing primer TAGGTACATTGAGCAACTGA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Synthetic ribosomal binding sites were used to
achieve different levels of expression, as previously described (Zelcbuch
et al., 2013).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCBB was a gift from Ron Milo (Addgene plasmid # 102248)

  • For your References section:

    Sugar Synthesis from CO2 in Escherichia coli. Antonovsky N, Gleizer S, Noor E, Zohar Y, Herz E, Barenholz U, Zelcbuch L, Amram S, Wides A, Tepper N, Davidi D, Bar-On Y, Bareia T, Wernick DG, Shani I, Malitsky S, Jona G, Bar-Even A, Milo R. Cell. 2016 Jun 30;166(1):115-25. doi: 10.1016/j.cell.2016.05.064. Epub 2016 Jun 23. 10.1016/j.cell.2016.05.064 PubMed 27345370
Related items: