Skip to main content

pLentiCRISPR sgSLC19A1
(Plasmid #102314)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102314 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPR
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sgSLC19A1
  • gRNA/shRNA sequence
    CGAGTTGAAGACCCACCAGA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    30
  • Entrez Gene
    SLC19A1 (a.k.a. CHMD, FOLT, IFC-1, IFC1, MEGAF, REFC, RFC, RFC1, RFT-1, hRFC, hSLC19A1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB1 (unknown if destroyed)
  • 3′ cloning site BsmB1 (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPR sgSLC19A1 was a gift from David Sabatini (Addgene plasmid # 102314 ; http://n2t.net/addgene:102314 ; RRID:Addgene_102314)
  • For your References section:

    Histidine catabolism is a major determinant of methotrexate sensitivity. Kanarek N, Keys HR, Cantor JR, Lewis CA, Chan SH, Kunchok T, Abu-Remaileh M, Freinkman E, Schweitzer LD, Sabatini DM. Nature. 2018 Jul 11. pii: 10.1038/s41586-018-0316-7. doi: 10.1038/s41586-018-0316-7. 10.1038/s41586-018-0316-7 PubMed 29995852