Skip to main content
Addgene

Pink Flamindo
(Plasmid #102356)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102356 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(-)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pink Flamindo
  • Insert Size (bp)
    1176
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pink Flamindo was a gift from Tetsuya Kitaguchi (Addgene plasmid # 102356 ; http://n2t.net/addgene:102356 ; RRID:Addgene_102356)
  • For your References section:

    Red fluorescent protein-based cAMP indicator applicable to optogenetics and in vivo imaging. Harada K, Ito M, Wang X, Tanaka M, Wongso D, Konno A, Hirai H, Hirase H, Tsuboi T, Kitaguchi T. Sci Rep. 2017 Aug 4;7(1):7351. doi: 10.1038/s41598-017-07820-6. 10.1038/s41598-017-07820-6 [pii] PubMed 28779099