-
Purposebiosensor for cAMP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(-)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePink Flamindo
-
Insert Size (bp)1176
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pink Flamindo was a gift from Tetsuya Kitaguchi (Addgene plasmid # 102356 ; http://n2t.net/addgene:102356 ; RRID:Addgene_102356) -
For your References section:
Red fluorescent protein-based cAMP indicator applicable to optogenetics and in vivo imaging. Harada K, Ito M, Wang X, Tanaka M, Wongso D, Konno A, Hirai H, Hirase H, Tsuboi T, Kitaguchi T. Sci Rep. 2017 Aug 4;7(1):7351. doi: 10.1038/s41598-017-07820-6. 10.1038/s41598-017-07820-6 [pii] PubMed 28779099