pAH1 (lenti hLPL-FLAG)
(Plasmid
#102448)
-
PurposeFLAG-tagged human LPL in lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRRL-cPPT-MCS-IRES-Puro
- Backbone size w/o insert (bp) 8041
- Total vector size (bp) 9591
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLipoprotein lipase
-
Alt nameLPL
-
SpeciesH. sapiens (human)
-
Entrez GeneLPL (a.k.a. HDLCQ11, LIPD)
- Promoter CMV
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- 6x His (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTGGGAGGTCTATATAAGCAGAGCTCG
- 3′ sequencing primer CTCACATTGCCAAAAGACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAH1 (lenti hLPL-FLAG) was a gift from Brandon Davies (Addgene plasmid # 102448 ; http://n2t.net/addgene:102448 ; RRID:Addgene_102448) -
For your References section:
Angiopoietin-like 4 Modifies the Interactions between Lipoprotein Lipase and Its Endothelial Cell Transporter GPIHBP1. Chi X, Shetty SK, Shows HW, Hjelmaas AJ, Malcolm EK, Davies BS. J Biol Chem. 2015 May 8;290(19):11865-77. doi: 10.1074/jbc.M114.623769. Epub 2015 Mar 25. 10.1074/jbc.M114.623769 PubMed 25809481