-
PurposeExpress Human RAD51 protein codon optimzed for E.coli and the E.coli GorE Operon
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102562 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCOLADuet-1
-
Backbone manufacturerNovagen.EMD Millipore
- Backbone size w/o insert (bp) 3719
- Total vector size (bp) 6645
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionswe use the plasmid to express RAD51 in E.coli Acella cells (Edge Bio) which have a RecA deletion that is required for purification.
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameHomo sapiens RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) (RAD51), transcript variant 1
-
Alt nameRAD51
-
Alt nameDNA repair protein RAD51 homolog 1
-
Alt nameRAD51A
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1020
-
MutationCodon optimized for E.coli Expression
-
GenBank IDNM_002875.4
-
Entrez GeneRAD51 (a.k.a. BRCC5, FANCR, HRAD51, HsRad51, HsT16930, MRMV2, RAD51A, RECA)
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TCAGAGCCGCTCAGACCATAGC
- 3′ sequencing primer TCGCACCGGCAAAACGCAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameE. coli groE operon
-
Alt nameGroE
-
Alt nameGroEL
-
Alt nameGroES
-
SpeciesE. Coli
-
Insert Size (bp)1986
-
GenBank IDX07850
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer cgtattgtacacggccgcataatcg
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was specifically designed to allow high levels of RAD51 expression in E.coli along with the ability to incorporate non-natural amino acids using amber suppressor technology. It was used to incorporate an artificial amino acid to mimic tyrosine phosphorylation (published in Subramanyam S, et. al. (2016). Proceedings of the National Academy of Sciences 113(41):E6045-E6054).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCH1/RAD51o was a gift from Maria Spies (Addgene plasmid # 102562 ; http://n2t.net/addgene:102562 ; RRID:Addgene_102562) -
For your References section:
Tyrosine phosphorylation stimulates activity of human RAD51 recombinase through altered nucleoprotein filament dynamics. Subramanyam S, Ismail M, Bhattacharya I, Spies M. Proc Natl Acad Sci U S A. 2016 Oct 11;113(41):E6045-E6054. Epub 2016 Sep 26. 10.1073/pnas.1604807113 PubMed 27671650