Skip to main content

pET_RTX
(Plasmid #102787)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102787 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    modified pET21
  • Total vector size (bp) 8230
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    reverse transcription xenopolymerase
  • Alt name
    RTX
  • Insert Size (bp)
    2328
  • Promoter T7 promoter + lac operator

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer gatctcgatcccgcgaaattaatacg
  • 3′ sequencing primer gctcagcggtggcagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET_RTX was a gift from Andrew Ellington (Addgene plasmid # 102787 ; http://n2t.net/addgene:102787 ; RRID:Addgene_102787)
  • For your References section:

    Synthetic evolutionary origin of a proofreading reverse transcriptase. Ellefson JW, Gollihar J, Shroff R, Shivram H, Iyer VR, Ellington AD. Science. 2016 Jun 24;352(6293):1590-3. doi: 10.1126/science.aaf5409. 10.1126/science.aaf5409 PubMed 27339990