STAGR_gRNAScaffold_mU6
(Plasmid
#102844)
-
PurposeCan be used as PCR template for a STAgR reaction
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102844 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePCR Template for STAgR Reactions
-
Backbone manufacturerStricker Lab
-
Vector typePCR Template for STAgR Inserts
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSTAgR Insert gRNAScaffold_mU6
- Promoter mU6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTTAGGGGCGGGACTATG
- 3′ sequencing primer TTACGGTTCCTGGCCTTTTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
STAGR_gRNAScaffold_mU6 was a gift from Stefan Stricker (Addgene plasmid # 102844 ; http://n2t.net/addgene:102844 ; RRID:Addgene_102844) -
For your References section:
One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR). Breunig CT, Durovic T, Neuner AM, Baumann V, Wiesbeck MF, Koferle A, Gotz M, Ninkovic J, Stricker SH. PLoS One. 2018 Apr 27;13(4):e0196015. doi: 10.1371/journal.pone.0196015. eCollection 2018. 10.1371/journal.pone.0196015 PubMed 29702666