Skip to main content
Addgene

U6-hGRIN2B-CAG-ps-SaCas9
(Plasmid #102853)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102853 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX462
  • Total vector size (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1
  • Species
    H. sapiens (human), Synthetic; S. aureus
  • Insert Size (bp)
    5872
  • Entrez Gene
    GRIN2B (a.k.a. DEE27, EIEE27, GluN2B, MRD6, NMDAR2B, NR2B, NR3, hNR3)
  • Promoter U6 promoter;
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3X Flag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagggcctatttcccatgat
  • 3′ sequencing primer aattaagcccaccttgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6-hGRIN2B-CAG-ps-SaCas9 was a gift from Michael Lin (Addgene plasmid # 102853 ; http://n2t.net/addgene:102853 ; RRID:Addgene_102853)
  • For your References section:

    A Single-Chain Photoswitchable CRISPR-Cas9 Architecture for Light-Inducible Gene Editing and Transcription. Zhou XX, Zou X, Chung HK, Gao Y, Liu Y, Qi LS, Lin MZ. ACS Chem Biol. 2017 Sep 29. doi: 10.1021/acschembio.7b00603. 10.1021/acschembio.7b00603 PubMed 28938067