-
PurposeExpresses GFP-Kif26b in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Davis
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 102862-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 102862-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEF5-FRT-V5-DEST
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 7528
- Total vector size (bp) 13229
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMouse Kif26b
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6341
-
GenBank IDNP_001155137.1
-
Entrez GeneKif26b (a.k.a. 4832420M10, BC056349, D230039L06Rik)
- Promoter EF1A
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer EF1A promoter forward (TCAAGCCTCAGACAGTGGTTC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 102862-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 102862-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF5-FRT-V5-DEST-GFP-Kif26b was a gift from Henry Ho (Addgene plasmid # 102862 ; http://n2t.net/addgene:102862 ; RRID:Addgene_102862) -
For your References section:
Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates. Susman MW, Karuna EP, Kunz RC, Gujral TS, Cantu AV, Choi SS, Jong BY, Okada K, Scales MK, Hum J, Hu LS, Kirschner MW, Nishinakamura R, Yamada S, Laird DJ, Jao LE, Gygi SP, Greenberg ME, Ho HH. Elife. 2017 Sep 8;6. pii: e26509. doi: 10.7554/eLife.26509. 10.7554/eLife.26509 PubMed 28885975