-
PurposeExpresses GFP-Kif26b in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEF5-FRT-V5-DEST
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 7528
- Total vector size (bp) 13229
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMouse Kif26b
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6341
-
GenBank IDNP_001155137.1
-
Entrez GeneKif26b (a.k.a. 4832420M10, BC056349, D230039L06Rik)
- Promoter EF1A
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer EF1A promoter forward (TCAAGCCTCAGACAGTGGTTC) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF5-FRT-V5-DEST-GFP-Kif26b was a gift from Henry Ho (Addgene plasmid # 102862 ; http://n2t.net/addgene:102862 ; RRID:Addgene_102862) -
For your References section:
Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates. Susman MW, Karuna EP, Kunz RC, Gujral TS, Cantu AV, Choi SS, Jong BY, Okada K, Scales MK, Hum J, Hu LS, Kirschner MW, Nishinakamura R, Yamada S, Laird DJ, Jao LE, Gygi SP, Greenberg ME, Ho HH. Elife. 2017 Sep 8;6. pii: e26509. doi: 10.7554/eLife.26509. 10.7554/eLife.26509 PubMed 28885975