ET8-GPIba-6His
(Plasmid
#102878)
-
PurposeWild type human platelet membrane protein GPIb alpha (1-290aa) with 6Histag at the C-terminus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneET8
- Backbone size w/o insert (bp) 5374
- Total vector size (bp) 6244
-
Modifications to backboneThe ET8 vector was modified from the commercial vector pIRES2-EGFP from BD Biosciences.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman platelet membrane protein GPIb alpha 1-290aa
-
Alt nameGPIba
-
SpeciesH. sapiens (human)
-
Insert Size (bp)870
-
Entrez GeneGP1BA (a.k.a. BDPLT1, BDPLT3, BSS, CD42B, CD42b-alpha, DBPLT3, GP1B, GPIbA, GPIbalpha, VWDP)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- 6xHis tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer TCTCGACACCCTTCTCCTCCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ET8-GPIba-6His was a gift from Timothy Springer (Addgene plasmid # 102878 ; http://n2t.net/addgene:102878 ; RRID:Addgene_102878) -
For your References section:
Flow-induced elongation of von Willebrand factor precedes tension-dependent activation. Fu H, Jiang Y, Yang D, Scheiflinger F, Wong WP, Springer TA. Nat Commun. 2017 Aug 23;8(1):324. doi: 10.1038/s41467-017-00230-2. 10.1038/s41467-017-00230-2 [pii] PubMed 28831047