Skip to main content

pOsTIR1w/oGFP
(Plasmid #102883)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102883 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    HO-poly-KanMX4-HO
  • Backbone manufacturer
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC55758/
  • Backbone size w/o insert (bp) 6024
  • Total vector size (bp) 8711
  • Vector type
    Yeast Expression
  • Selectable markers
    KanMX4 (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OsTIR1
  • Alt name
    Auxin Inducible Degron
  • Alt name
    AID
  • Species
    Oryza sativa
  • Insert Size (bp)
    2689
  • Promoter ADH1
  • Tag / Fusion Protein
    • 3x myc

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGAGTATTGTGTCATGTTCG
  • 3′ sequencing primer GACAGTCACATCATGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The OsTIR1 was retrieved from: Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., and Kanemaki, M. (2009). An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat. Methods 6, 917–922. The HO-poly-KanMX4-HO plasmid was retrieved from: Voth, W.P., Richards, J.D., Shaw, J.M., and Stillman, D.J. (2001). Yeast vectors for integration at the HO locus. Nucleic Acids Res. 29, E59-9.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid can be used to assemble the auxin inducible degron in single yeast cells.

A characterization guide can be found here:
https://www.nature.com/articles/s41598-017-04791-6

Detailed description of plasmid construction can be found in the Supplemental Experimental Procedures of the original paper:
http://www.cell.com/molecular-cell/pdfExtended/S1097-2765(16)30726-2

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOsTIR1w/oGFP was a gift from Matthias Heinemann (Addgene plasmid # 102883 ; http://n2t.net/addgene:102883 ; RRID:Addgene_102883)
  • For your References section:

    Autonomous Metabolic Oscillations Robustly Gate the Early and Late Cell Cycle. Papagiannakis A, Niebel B, Wit EC, Heinemann M. Mol Cell. 2017 Jan 19;65(2):285-295. doi: 10.1016/j.molcel.2016.11.018. Epub 2016 Dec 15. 10.1016/j.molcel.2016.11.018 PubMed 27989441