pOsTIR1w/oGFP
(Plasmid #102883)

• Purpose: Expresses OsTIR1 via the ADH1 promoter in yeast. The cassette is integrated in the HO locus. Assembly and characterization of the auxin-inducible degradation.
• Depositing Lab: Matthias Heinemann
• Publication: Papagiannakis et al Mol Cell. 2017 Jan 19;65(2):285-295. doi: 10.1016/j.molcel.2016.11.018. Epub 2016 Dec 15.

Backbone

• Vector backbone: HO-poly-KanMX4-HO
• Backbone manufacturer: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC55758/
• Backbone size w/o insert (bp): 6024
• Total vector size (bp): 8711
• Vector type: Yeast Expression
• Selectable markers: KanMX4 (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: OsTIR1
• Alt name: Auxin Inducible Degron
• Alt name: AID
• Species: Oryza sativa
• Insert Size (bp): 2689
• Promoter: ADH1
• Tag / Fusion Protein:
  • 3x myc

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGAGTATTGTGTCATGTTCG
• 3′ sequencing primer: GACAGTCACATCATGCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The OsTIR1 was retrieved from: Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., and Kanemaki, M. (2009). An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat. Methods 6, 917–922. The HO-poly-KanMX4-HO plasmid was retrieved from: Voth, W.P., Richards, J.D., Shaw, J.M., and Stillman, D.J. (2001). Yeast vectors for integration at the HO locus. Nucleic Acids Res. 29, E59-9.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid can be used to assemble the auxin inducible degron in single yeast cells.

A characterization guide can be found here:
https://www.nature.com/articles/s41598-017-04791-6

Detailed description of plasmid construction can be found in the Supplemental Experimental Procedures of the original paper:
http://www.cell.com/molecular-cell/pdfExtended/S1097-2765(16)30726-2