pOsTIR1w/oGFP
(Plasmid
#102883)
-
PurposeExpresses OsTIR1 via the ADH1 promoter in yeast. The cassette is integrated in the HO locus. Assembly and characterization of the auxin-inducible degradation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 102883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneHO-poly-KanMX4-HO
-
Backbone manufacturerhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC55758/
- Backbone size w/o insert (bp) 6024
- Total vector size (bp) 8711
-
Vector typeYeast Expression
-
Selectable markersKanMX4 (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOsTIR1
-
Alt nameAuxin Inducible Degron
-
Alt nameAID
-
SpeciesOryza sativa
-
Insert Size (bp)2689
- Promoter ADH1
-
Tag
/ Fusion Protein
- 3x myc
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGAGTATTGTGTCATGTTCG
- 3′ sequencing primer GACAGTCACATCATGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe OsTIR1 was retrieved from: Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., and Kanemaki, M. (2009). An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat. Methods 6, 917–922. The HO-poly-KanMX4-HO plasmid was retrieved from: Voth, W.P., Richards, J.D., Shaw, J.M., and Stillman, D.J. (2001). Yeast vectors for integration at the HO locus. Nucleic Acids Res. 29, E59-9.
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
This plasmid can be used to assemble the auxin inducible degron in single yeast cells.
A characterization guide can be found here:
https://www.nature.com/articles/s41598-017-04791-6
Detailed description of plasmid construction can be found in the Supplemental Experimental Procedures of the original paper:
http://www.cell.com/molecular-cell/pdfExtended/S1097-2765(16)30726-2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOsTIR1w/oGFP was a gift from Matthias Heinemann (Addgene plasmid # 102883 ; http://n2t.net/addgene:102883 ; RRID:Addgene_102883) -
For your References section:
Autonomous Metabolic Oscillations Robustly Gate the Early and Late Cell Cycle. Papagiannakis A, Niebel B, Wit EC, Heinemann M. Mol Cell. 2017 Jan 19;65(2):285-295. doi: 10.1016/j.molcel.2016.11.018. Epub 2016 Dec 15. 10.1016/j.molcel.2016.11.018 PubMed 27989441