-
PurposeExpress a lysosomal Tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLJC5
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLAMP1
-
SpeciesR. norvegicus (rat)
- Promoter ubc
-
Tag
/ Fusion Protein
- RFP-HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcorI (not destroyed)
- 5′ sequencing primer CGAAGGAATAGAAGAAGAAGGTGGAGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
LAMP1-RFP was cloned from Plasmid #34611
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJC5-LAMP1-RFP-3xHA was a gift from David Sabatini (Addgene plasmid # 102932 ; http://n2t.net/addgene:102932 ; RRID:Addgene_102932) -
For your References section:
Lysosomal metabolomics reveals V-ATPase- and mTOR-dependent regulation of amino acid efflux from lysosomes. Abu-Remaileh M, Wyant GA, Kim C, Laqtom NN, Abbasi M, Chan SH, Freinkman E, Sabatini DM. Science. 2017 Nov 10;358(6364):807-813. doi: 10.1126/science.aan6298. Epub 2017 Oct 26. 10.1126/science.aan6298 PubMed 29074583